Набор реагентов ГенТест CES1

Набор реагентов для выявления полиморфизмов и аллельных вариантов в гене человека CES1 методом ПЦР-РВ

Только для применения в научно-исследовательских целях.
Не для применения в медицине или ветеринарии.

Ген CES1 кодирует карбоксилэстеразу, участвующую в биотрансформации эндогенных и экзогенных веществ, в том числе лекарственных средств и пролекарств, и в биоинактивации эфиров, амидов, карбаматов тиоэфиров и локально-стабильных соединений. Нуклеотидная замена C на A в позиции -33 приводит к синтезу фермента со сниженной активностью, замедляющей катаболизм Ацил-КоА, ацилкарнитина, триацилглицерина, эфиров холестерина, дабигатран этексилата, аспирина, капецитабина, цилазаприла, клопидогрела, кокаина, эналаприла, героина, имидаприла, иринотекана, меперидина, метилфенидата, олмесартана, орлистата, осельтамивира, квинаприла, рамиприла, тэмолаприла, фталатов, бензоатов, пиретроидов, пиретринов, фосфорорганических соединений, пестицидов, антипиренов. Таким образом, мутации в CES1 нарушают метаболические процессы, снижают устойчивость организма к ксенобиотикам и модифицируют фармакокинетику лекарственных препаратов.

Определяемые мутации

Набор реагентовАллельный вариантНоменклатура HGVSИдентификатор dbSNPФланкирующая последовательность
ГенТест CES1 CES1 c(-33)a NG_012057.1:g.27467C>A
NM_001266.4:c.1165-33C>A
rs2244613 GAGAAGCTGCATCGCTCACC[С/A]
GGGGCTGGTGGTCACTTTTT

Характеристики наборов реагентов

  • Анализ обоих аллелей в одной пробирке.
  • Два канала детекции – FAM и HEX.
  • Анализ от 10 до 44 образцов.
  • Использование ДНК, выделенной из крови, буккального эпителия, тканей.
  • Предел обнаружения – от 0.2 нг/мкл ДНК.
  • Автоматический анализ результатов с помощью ПО ГенТест.
Программное обеспечение (ПО)
Скачать (exe)
Инструкция к ПО
Скачать (pdf)

Совместимость с приборами

CFX96 Touch Real-Time PCR Detection System (Bio-Rad).

Шаблоны программ ПЦР и разметки плашек

CFX96
Программа ПЦРРазметка плашки
ГенТест CES1
НазваниеКат.№Анализируемые полиморфизмы/ аллельные варианты Количество образцовЦена, руб. Инструкция
ГенТест CES1 R2004 CES1 c(-33)a От 10 до 44 7 000

Контакты

Сделать заказ

  • Для корреспонденции:
    ООО «Новые Молекулярные Технологии» (ООО «НОМОТЕК»)
    117997, Россия, г. Москва, ул. Миклухо-Маклая, 16/10, корп. 16

Консультация 
по наборам