Набор реагентов ГенТест CYP2C9, VKORC1, CYP4F2

Набор реагентов для выявления полиморфизмов и аллельных вариантов в генах человека CYP2C9, CYP4F2, VKORC1 методом ПЦР-РВ

Только для применения в научно-исследовательских целях.
Не для применения в медицине или ветеринарии.

Гены CYP2C9 и CYP4F2 кодируют ферменты семейства цитохоромов Р-450, участвующие в метаболизме лекарственных средств. Аллельные варианты CYP2C9*2, CYP2C9*3 и CYP4F2*3 снижают метаболизм варфарина, аценокумарола, фенитоина, толбутамида, целекоксиба, ибупрофена, натеглинида, глимепирида, флувастатина, фенпрокумона и др. лекарственных средств. Ген VKORC1 кодирует субъединицу 1 витамин К-эпоксидредуктазного комплекса – ключевого фермента цикла витамина К. Замена -1639G>A снижает синтез VKORC1 и подавляет восстановление витамина К. Как следствие, падает активность факторов свертываемости крови VII, IX и X. Аллельные варианты CYP2C9, CYP4F2 и VKORC1 ассоциированы с риском развития кровотечения в сочетании с антикоагулянтами, в т.ч. варфарином.

Определяемые мутации

Набор реагентовАллельный вариантНоменклатура HGVSИдентификатор dbSNPФланкирующая последовательность
ГенТест CYP2C9, VKORC1, CYP4F2 CYP2C9*2 NG_008385.1:g.8633C>T
NM_000771.3:c.430C>T
NP_000762.2:p.Arg144Cys
rs1799853 GGAAGAGGAGCATTGAGGAC[C/T]
GTGTTCAAGAGGAAGCCCGC
CYP2C9*3 NG_008385.1:g.47639A>C
NM_000771.3:c.1100A>C
NP_000762.2:p.Ile359Leu
rs1057910 TGCACGAGGTCCAGAGATAC[A/C]
TTGACCTTCTCCCCACCAGC
VKORC1*2 NG_011564.1:g.3588G>A
NM_206824.2:c.-1639G>A
rs9923231 CTGAAAAACAACCATTGGCC[G/A]
GGTGCGGTGGCTCACGCCTA
CYP4F2*3 NG_007971.2:g.23454G>A
NM_001082.5:c.1297G>A
NP_001073.3:p.Val433Met
rs2108622 GAACCCATCACAACCCAGCT[G/A]
TGTGGCCGGACCCTGAGGTG

Характеристики наборов реагентов

  • Комплексный фармакогенетический скрининг мутаций в системе гемостаза.
  • Анализ обоих аллелей одного аллельного варианта в одной пробирке.
  • Два канала детекции – FAM и HEX.
  • Анализ от 10 до 44 образцов.
  • Использование ДНК, выделенной из крови, буккального эпителия, тканей.
  • Предел обнаружения – от 0.2 нг/мкл ДНК.
  • Автоматический анализ результатов с помощью ПО ГенТест.
Программное обеспечение (ПО)
Скачать (exe)
Инструкция к ПО
Скачать (pdf)

Совместимость с приборами

CFX96 Touch Real-Time PCR Detection System (Bio-Rad).

Шаблоны программ ПЦР и разметки плашек

CFX96
Программа ПЦРРазметка плашки
ГенТест CYP2C9, VKORC1, CYP4F2
НазваниеКат.№ Анализируемые полиморфизмы/ аллельные вариантыКоличество образцов Цена, руб. Инструкция
ГенТест CYP2C9, VKORC1, CYP4F2 R2002 CYP2C9*2
CYP2C9*3
VKORC1*2
CYP4F2*3
От 10 до 44 7 000

Контакты

Сделать заказ

  • Для корреспонденции:
    ООО «Новые Молекулярные Технологии» (ООО «НОМОТЕК»)
    117997, Россия, г. Москва, ул. Миклухо-Маклая, 16/10, корп. 16

Консультация 
по наборам