Набор реагентов ГенТест F2, F5

Набор реагентов для выявления полиморфизмов в генах человека F2 и F5 методом ПЦР-РВ

Только для применения в научно-исследовательских целях.
Не для применения в медицине или ветеринарии.

Ген F2 кодирует фактор свертывания крови II (протромбин). Нуклеотидная замена 97G>A в гене F2 приводит к повышению экспрессии белка и увеличению концентрации протромбина в крови. Ген F5 кодирует фактор свертывания крови V. Нуклеотидная замена 1601G>A в гене F5 (мутация Лейдена) предотвращает инактивацию белка F5, активированным протеином C. Обе мутации в генах F2 и F5 повышают риск образования тромбов.

Определяемые мутации

Набор реагентовАллельный вариантНоменклатура HGVSИдентификатор dbSNPФланкирующая последовательность
ГенТест F2, F5 G97A NG_008953.1:g.25313G>A
NM_001311257.1:c.*97G>A
rs1799963 AATAAAAGTGACTCTCAGC[G/A]
AGCCTCAATGCTCCCAGTGC
G1601A NG_011806.1:g.41721G>A
NM_000130.4:c.1601G>A
NP_000121.2:p.Arg534Gln
rs6025 GAGCAGATCCCTGGACAGGC[G/A]
AGGAATACAGGTATTTTGTC

Характеристики наборов реагентов

  • Комплексный фармакогенетический скрининг мутаций в системе гемостаза.
  • Анализ обоих аллелей одного аллельного варианта в одной пробирке.
  • Два канала детекции – FAM и HEX.
  • Анализ от 10 до 44 образцов.
  • Использование ДНК, выделенной из крови, буккального эпителия, тканей.
  • Предел обнаружения – от 0.2 нг/мкл ДНК.
  • Автоматический анализ результатов с помощью ПО ГенТест.
Программное обеспечение (ПО)
Скачать (exe)
Инструкция к ПО
Скачать (pdf)

Совместимость с приборами

CFX96 Touch Real-Time PCR Detection System (Bio-Rad).

Шаблоны программ ПЦР и разметки плашек

CFX96
Программа ПЦРРазметка плашки
ГенТест F2, F5
НазваниеКат.№Анализируемые полиморфизмы/ аллельные варианты Количество образцовЦена, руб. Инструкция
ГенТест F2, F5 R2005 F2 G97A
F5 G1601A
От 10 до 44 12 000

Контакты

Сделать заказ

  • Для корреспонденции:
    ООО «Новые Молекулярные Технологии» (ООО «НОМОТЕК»)
    117997, Россия, г. Москва, ул. Миклухо-Маклая, 16/10, корп. 16

Консультация 
по наборам