Набор реагентов ГенТест SLCO1B1

Набор реагентов для выявления полиморфизмов и аллельных вариантов в гене человека SLCO1B1 методом ПЦР-РВ

Только для применения в научно-исследовательских целях.
Не для применения в медицине или ветеринарии.

Ген SLCO1B1 кодирует транспортный белок SLCO1B1 (синонимы – OATP1B1, OATP-C), который стимулирует интернализацию статинов клетками печени. Наиболее значимым полиморфным вариантом гена является rs4149056, характеризующийся транзицией T на C в кодирующей области c.521T>C. Носительство аллеля С ассоциировано со снижением транспортной активности белка SLCO1B1, увеличением времени циркуляции статинов в крови и возрастанием риска токсических эффектов – миопатии, рабдомиолиза и почечной недостаточности.

Определяемые мутации

Набор реагентовАллельный вариантНоменклатура HGVSИдентификатор dbSNPФланкирующая последовательность
ГенТест SLCO1B1 SLCO1B1c.521 T>C NG_011745.1:g.52422T>C
NM_006446.4:c.521T>C
NP_006437.3:p.Val174Ala
rs4149056 GTCATACATGTGGATATATG[T/C]
GTTCATGGGTAATATGCTTC

Характеристики наборов реагентов

  • Анализ обоих аллелей в одной пробирке.
  • Два канала детекции – FAM и HEX.
  • Анализ от 10 до 44 образцов.
  • Использование ДНК, выделенной из крови, буккального эпителия, тканей.
  • Предел обнаружения – от 0.2 нг/мкл ДНК.
  • Автоматический анализ результатов с помощью ПО ГенТест.
Программное обеспечение (ПО)
Скачать (exe)
Инструкция к ПО
Скачать (pdf)

Совместимость с приборами

CFX96 Touch Real-Time PCR Detection System (Bio-Rad).

Шаблоны программ ПЦР и разметки плашек

CFX96
Программа ПЦРРазметка плашки
ГенТест SLCO1B1
НазваниеКат.№Анализируемые полиморфизмы/ аллельные варианты Количество образцовЦена, руб. Инструкция
ГенТест SLCO1B1 R2003 SLCO1B1c.521 T>C От 10 до 44 7 000

Контакты

Сделать заказ

  • Для корреспонденции:
    ООО «Новые Молекулярные Технологии» (ООО «НОМОТЕК»)
    117997, Россия, г. Москва, ул. Миклухо-Маклая, 16/10, корп. 16

Консультация 
по наборам